SeqAn3 3.4.0
The Modern C++ library for sequence analysis.
Loading...
Searching...
No Matches
seqan3::dot_bracket3 Class Reference

The three letter RNA structure alphabet of the characters ".()". More...

#include <seqan3/alphabet/structure/dot_bracket3.hpp>

+ Inheritance diagram for seqan3::dot_bracket3:

Public Member Functions

Constructors, destructor and assignment
constexpr dot_bracket3 () noexcept=default
 Defaulted.
 
constexpr dot_bracket3 (dot_bracket3 const &) noexcept=default
 Defaulted.
 
constexpr dot_bracket3 (dot_bracket3 &&) noexcept=default
 Defaulted.
 
constexpr dot_bracket3 & operator= (dot_bracket3 const &) noexcept=default
 Defaulted.
 
constexpr dot_bracket3 & operator= (dot_bracket3 &&) noexcept=default
 Defaulted.
 
 ~dot_bracket3 () noexcept=default
 Defaulted.
 
- Public Member Functions inherited from seqan3::alphabet_base< dot_bracket3, 3 >
constexpr alphabet_base () noexcept=default
 Defaulted.
 
constexpr alphabet_base (alphabet_base const &) noexcept=default
 Defaulted.
 
constexpr alphabet_base (alphabet_base &&) noexcept=default
 Defaulted.
 
constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
 Defaulted.
 
constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
 Defaulted.
 
 ~alphabet_base () noexcept=default
 Defaulted.
 
constexpr char_type to_char () const noexcept
 Return the letter as a character of char_type.
 
constexpr rank_type to_rank () const noexcept
 Return the letter's numeric value (rank in the alphabet).
 
constexpr dot_bracket3 & assign_char (char_type const chr) noexcept
 Assign from a character, implicitly converts invalid characters.
 
constexpr dot_bracket3 & assign_rank (rank_type const c) noexcept
 Assign from a numeric value.
 

RNA structure properties

static constexpr uint8_t max_pseudoknot_depth {1u}
 The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.
 
constexpr bool is_pair_open () const noexcept
 Check whether the character represents a rightward interaction in an RNA structure.
 
constexpr bool is_pair_close () const noexcept
 Check whether the character represents a leftward interaction in an RNA structure.
 
constexpr bool is_unpaired () const noexcept
 Check whether the character represents an unpaired position in an RNA structure.
 
constexpr std::optional< uint8_t > pseudoknot_id () const noexcept
 Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id.
 

Additional Inherited Members

- Static Public Attributes inherited from seqan3::alphabet_base< dot_bracket3, 3 >
static constexpr detail::min_viable_uint_t< size > alphabet_size
 The size of the alphabet, i.e. the number of different values it can take.
 
- Protected Types inherited from seqan3::alphabet_base< dot_bracket3, 3 >
using char_type = std::conditional_t< std::same_as< char, void >, char, char >
 The char representation; conditional needed to make semi alphabet definitions legal.
 
using rank_type = detail::min_viable_uint_t< size - 1 >
 The type of the alphabet when represented as a number (e.g. via to_rank()).
 

Detailed Description

The three letter RNA structure alphabet of the characters ".()".

The brackets denote RNA base pair interactions. Every left bracket must have a corresponding right bracket. Pseudoknots cannot be expressed in this format. A dot (.) represents a character that is not paired.

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))).

Example

// SPDX-FileCopyrightText: 2006-2025 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2025 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
int main()
{
using namespace seqan3::literals;
seqan3::dot_bracket3 letter{'.'_db3};
letter.assign_char('(');
seqan3::debug_stream << letter << '\n'; // prints "("
letter.assign_char('F'); // Unknown characters are implicitly converted to '.'.
seqan3::debug_stream << letter << '\n'; // prints "."
}
constexpr derived_type & assign_char(char_type const chr) noexcept
Assign from a character, implicitly converts invalid characters.
Definition alphabet_base.hpp:160
The three letter RNA structure alphabet of the characters ".()".
Definition dot_bracket3.hpp:51
Provides seqan3::debug_stream and related types.
Provides the dot bracket format for RNA structure.
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition debug_stream.hpp:38
The SeqAn namespace for literals.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

Member Function Documentation

◆ is_pair_close()

constexpr bool seqan3::dot_bracket3::is_pair_close ( ) const
inlineconstexprnoexcept

Check whether the character represents a leftward interaction in an RNA structure.

Returns
True if the letter represents a leftward interaction, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ is_pair_open()

constexpr bool seqan3::dot_bracket3::is_pair_open ( ) const
inlineconstexprnoexcept

Check whether the character represents a rightward interaction in an RNA structure.

Returns
True if the letter represents a rightward interaction, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ is_unpaired()

constexpr bool seqan3::dot_bracket3::is_unpaired ( ) const
inlineconstexprnoexcept

Check whether the character represents an unpaired position in an RNA structure.

Returns
True if the letter represents an unpaired site, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ pseudoknot_id()

constexpr std::optional< uint8_t > seqan3::dot_bracket3::pseudoknot_id ( ) const
inlineconstexprnoexcept

Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id.

Returns
The pseudoknot id (always 0) if alph denotes an interaction, and no value otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

Member Data Documentation

◆ max_pseudoknot_depth

constexpr uint8_t seqan3::dot_bracket3::max_pseudoknot_depth {1u}
staticconstexpr

The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.

It is the number of distinct pairs of interaction symbols the format supports. The value 1 denotes no pseudoknot support.

This entity is experimental and subject to change in the future. Experimental since version 3.1.


The documentation for this class was generated from the following file:
Hide me